Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 1094114
End position: 1094137
Length: 24

DNA sequence
>NC_013222, from 1094114 to 1094137 (24 bp); Robiginitalea biformata HTCC2501 CTCCTCCACCTCCTGCTCTTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 1093572-1094294	Sequence	RB2501_08285 - hypothetical protein (Protein is coded in complementary strand; from 1094294 to 1093572)