Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 598961
End position: 598996
Length: 36

DNA sequence
>NC_013222, from 598961 to 598996 (36 bp); Robiginitalea biformata HTCC2501 TCCAGTTCCCGTTCGAGTTCCAATTCCAGTTCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 598841-599053	Sequence	RB2501_06040 - hypothetical protein (Protein is coded in complementary strand; from 599053 to 598841)