Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 687970
End position: 687993
Length: 24

DNA sequence
>NC_013222, from 687970 to 687993 (24 bp); Robiginitalea biformata HTCC2501 CGGACCCGGACGGGGACCCGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 687685-688224	Sequence	RB2501_06465 - RNA polymerase ECF-type sigma factor