Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 3362732
End position: 3362755
Length: 24

DNA sequence
>NC_013222, from 3362732 to 3362755 (24 bp); Robiginitalea biformata HTCC2501 GGTCCAGGTCCGCGTCCAGGTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 3362311-3363147	Sequence	RB2501_02525 - hypothetical protein (Protein is coded in complementary strand; from 3363147 to 3362311)