Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 1328970
End position: 1328993
Length: 24

DNA sequence
>NC_013222, from 1328970 to 1328993 (24 bp); Robiginitalea biformata HTCC2501 TCGGGTTGGGGTTCGGGCTCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 1328361-1329068	Sequence	RB2501_09315 - hypothetical protein (Protein is coded in complementary strand; from 1329068 to 1328361)