Sequence retrieval

Genome: Lactobacillus rhamnosus GG
Start position: 298922
End position: 298966
Length: 45

DNA sequence
>NC_013198, from 298922 to 298966 (45 bp); Lactobacillus rhamnosus GG TGTTCTGCTGCAGCTTTTTCGGCTGCGGCTTTTTCAGCTGCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 298547-299227	Sequence	LGG_00293 - hypothetical protein (Protein is coded in complementary strand; from 299227 to 298547)