Sequence retrieval

Genome: Lactobacillus rhamnosus GG
Start position: 2351731
End position: 2351775
Length: 45

DNA sequence
>NC_013198, from 2351731 to 2351775 (45 bp); Lactobacillus rhamnosus GG TTGTGTTGGCTTCGTTTGTGTTGGCTTCGTCTGTGTTGGCTTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2351546-2355847	Sequence	LGG_02282 - hypothetical protein (Protein is coded in complementary strand; from 2355847 to 2351546)