Sequence retrieval

Genome: Lactobacillus rhamnosus GG
Start position: 452400
End position: 452429
Length: 30

DNA sequence
>NC_013198, from 452400 to 452429 (30 bp); Lactobacillus rhamnosus GG TGATTATTACGGATTAGTACTGATTCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 451872-453659	Sequence	LGG_00449 - UvrD/REP helicase (Protein is coded in complementary strand; from 453659 to 451872)