Sequence retrieval

Genome: Lactobacillus rhamnosus GG
Start position: 2666709
End position: 2666738
Length: 30

DNA sequence
>NC_013198, from 2666709 to 2666738 (30 bp); Lactobacillus rhamnosus GG CCGCCACGGCCACCGCCGCCGCGACCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2666541-2667398	Sequence	LGG_02607 - methanol dehydrogenase-like protein (Protein is coded in complementary strand; from 2667398 to 2666541)