Sequence retrieval

Genome: Lactobacillus rhamnosus GG
Start position: 2530917
End position: 2530946
Length: 30

DNA sequence
>NC_013198, from 2530917 to 2530946 (30 bp); Lactobacillus rhamnosus GG AGCCACATAAAGCCGCAAAAAGCCACAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2530475-2531140	Sequence	LGG_02459 - hypothetical protein (Protein is coded in complementary strand; from 2531140 to 2530475)