Sequence retrieval

Genome: Lactobacillus rhamnosus GG
Start position: 1022623
End position: 1022652
Length: 30

DNA sequence
>NC_013198, from 1022623 to 1022652 (30 bp); Lactobacillus rhamnosus GG TCGTCATAGTCATCATCATCGTCGTCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1022308-1023492	Sequence	LGG_01012 - membrane protein (Protein is coded in complementary strand; from 1023492 to 1022308)