Sequence retrieval

Genome: Lactobacillus rhamnosus GG
Start position: 709488
End position: 709514
Length: 27

DNA sequence
>NC_013198, from 709488 to 709514 (27 bp); Lactobacillus rhamnosus GG GCTGCCCATGCTGCCCATGCCGCCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 709450-711657	Sequence	LGG_00696 ykcB 4-amino-4-deoxy-L-arabinose transferase-like glycosyltransferase of PMT family protein (Protein is coded in complementary strand; from 711657 to 709450)