Sequence retrieval

Genome: Lactobacillus rhamnosus GG
Start position: 1682752
End position: 1682775
Length: 24

DNA sequence
>NC_013198, from 1682752 to 1682775 (24 bp); Lactobacillus rhamnosus GG GGCAATCGCAATTGCAATGACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1682252-1683274	Sequence	LGG_01656 oppD oligopeptide ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 1683274 to 1682252)