Sequence retrieval

Genome: Lactobacillus rhamnosus GG
Start position: 1540430
End position: 1540453
Length: 24

DNA sequence
>NC_013198, from 1540430 to 1540453 (24 bp); Lactobacillus rhamnosus GG TGTTGCTTTTGCTGTTGCTGTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1538792-1542958	Sequence	LGG_01525 - phage-related minor tail protein (Protein is coded in complementary strand; from 1542958 to 1538792)