Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 879676
End position: 879705
Length: 30

DNA sequence
>NC_013173, from 879676 to 879705 (30 bp); Desulfomicrobium baculatum DSM 4028 AGGACCAGGATCAGGAGCAGGACCAGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 878950-879849	Sequence	Dbac_0804 - hypothetical protein (Protein is coded in complementary strand; from 879849 to 878950)