Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 837422
End position: 837466
Length: 45

DNA sequence
>NC_013173, from 837422 to 837466 (45 bp); Desulfomicrobium baculatum DSM 4028 GGCGCCCAGGACGGAGGCGCCCCGCGCGGAAGCGCTCCGGACGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 836379-838112	Sequence	Dbac_0759 - peptidoglycan-binding LysM (Protein is coded in complementary strand; from 838112 to 836379)