Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 538337
End position: 538364
Length: 28

DNA sequence
>NC_013173, from 538337 to 538364 (28 bp); Desulfomicrobium baculatum DSM 4028 CCATTCACCACTCACCGTTCACCATTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 538363-538983	Sequence	Dbac_0465 - hypothetical protein (Protein is coded in complementary strand; from 538983 to 538363)