Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 3580707
End position: 3580736
Length: 30

DNA sequence
>NC_013173, from 3580707 to 3580736 (30 bp); Desulfomicrobium baculatum DSM 4028 GGACTGACACGGACGAACACGGACGGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3580522-3581208	Sequence	Dbac_3165 - hypothetical protein (Protein is coded in complementary strand; from 3581208 to 3580522)