Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 3470610
End position: 3470634
Length: 25

DNA sequence
>NC_013173, from 3470610 to 3470634 (25 bp); Desulfomicrobium baculatum DSM 4028 CCCCGCCCTGGCCCGCCGCGCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3469928-3472402	Sequence	Dbac_3067 - heavy metal translocating P-type ATPase