Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 3375719
End position: 3375748
Length: 30

DNA sequence
>NC_013173, from 3375719 to 3375748 (30 bp); Desulfomicrobium baculatum DSM 4028 CCGGGGCCGGCCAGGGCCGCTCGGGGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3372940-3375858	Sequence	Dbac_2983 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 3375858 to 3372940)