Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 3268966
End position: 3269000
Length: 35

DNA sequence
>NC_013173, from 3268966 to 3269000 (35 bp); Desulfomicrobium baculatum DSM 4028 TCAAATTTCAAATCTTAAATTTCAAATCTTAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3268995-3269858	Sequence	Dbac_2887 - hypothetical protein (Protein is coded in complementary strand; from 3269858 to 3268995)