Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 3203398
End position: 3203421
Length: 24

DNA sequence
>NC_013173, from 3203398 to 3203421 (24 bp); Desulfomicrobium baculatum DSM 4028 GCGATGGCGATGGCAATGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3203056-3203952	Sequence	Dbac_2825 - zinc/iron permease (Protein is coded in complementary strand; from 3203952 to 3203056)