Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 3121792
End position: 3121815
Length: 24

DNA sequence
>NC_013173, from 3121792 to 3121815 (24 bp); Desulfomicrobium baculatum DSM 4028 ACGCCCACGCCCAGGCCCACGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3121621-3121890	Sequence	Dbac_2730 - flagellar biosynthetic protein FliQ (Protein is coded in complementary strand; from 3121890 to 3121621)