Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 3011160
End position: 3011186
Length: 27

DNA sequence
>NC_013173, from 3011160 to 3011186 (27 bp); Desulfomicrobium baculatum DSM 4028 CCGCCGCCTCCACCGCCTCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3011148-3013028	Sequence	Dbac_2636 - transmembrane signal peptide protein (Protein is coded in complementary strand; from 3013028 to 3011148)