Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 2991929
End position: 2991955
Length: 27

DNA sequence
>NC_013173, from 2991929 to 2991955 (27 bp); Desulfomicrobium baculatum DSM 4028 CATGCCGCCCATGCCGCCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2991924-2993561	Sequence	Dbac_2624 - chaperonin GroEL (Protein is coded in complementary strand; from 2993561 to 2991924)