Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 2930917
End position: 2930944
Length: 28

DNA sequence
>NC_013173, from 2930917 to 2930944 (28 bp); Desulfomicrobium baculatum DSM 4028 TGAATGGTGAATGATGATTGGTGAATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2930567-2930917	Sequence	Dbac_2570 - XRE family transcriptional regulator