Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 2893770
End position: 2893805
Length: 36

DNA sequence
>NC_013173, from 2893770 to 2893805 (36 bp); Desulfomicrobium baculatum DSM 4028 CGCTGCCTCTACCGCTGCCTCTACCGCTGCCTCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2893487-2893906	Sequence	Dbac_2533 - hypothetical protein (Protein is coded in complementary strand; from 2893906 to 2893487)