Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 2426869
End position: 2426913
Length: 45

DNA sequence
>NC_013173, from 2426869 to 2426913 (45 bp); Desulfomicrobium baculatum DSM 4028 AGCCGGGACCGACTCAGTCGGAACCGACGCAGTCGGAACCGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2426453-2426980	Sequence	Dbac_2117 - cytochrome P460 (Protein is coded in complementary strand; from 2426980 to 2426453)