Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 2375341
End position: 2375364
Length: 24

DNA sequence
>NC_013173, from 2375341 to 2375364 (24 bp); Desulfomicrobium baculatum DSM 4028 CGCCACCGCCACAGCCACCCCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2374754-2375395	Sequence	Dbac_2069 - lysine exporter protein LysE/YggA (Protein is coded in complementary strand; from 2375395 to 2374754)