Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 213551
End position: 213586
Length: 36

DNA sequence
>NC_013173, from 213551 to 213586 (36 bp); Desulfomicrobium baculatum DSM 4028 CACTGGTGGGGTGACTGGTGGGGTGACTGGTGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 213297-214733	Sequence	Dbac_0182 - transcriptional regulator (Protein is coded in complementary strand; from 214733 to 213297)