Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 2019645
End position: 2019668
Length: 24

DNA sequence
>NC_013173, from 2019645 to 2019668 (24 bp); Desulfomicrobium baculatum DSM 4028 GGCGTAGGTGTAGGCGCAGGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2019334-2020329	Sequence	Dbac_1775 - D-alanine--D-alanine ligase (Protein is coded in complementary strand; from 2020329 to 2019334)