Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 2002584
End position: 2002607
Length: 24

DNA sequence
>NC_013173, from 2002584 to 2002607 (24 bp); Desulfomicrobium baculatum DSM 4028 GCCACGGCCACGGTCACGACCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2001915-2003120	Sequence	Dbac_1759 - type II secretion system protein (Protein is coded in complementary strand; from 2003120 to 2001915)