Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 1928338
End position: 1928361
Length: 24

DNA sequence
>NC_013173, from 1928338 to 1928361 (24 bp); Desulfomicrobium baculatum DSM 4028 CTGGGCATGGGCCAGGGCCAGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1926905-1929244	Sequence	Dbac_1694 - capsular polysaccharide biosynthesis protein (Protein is coded in complementary strand; from 1929244 to 1926905)