Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 1892286
End position: 1892330
Length: 45

DNA sequence
>NC_013173, from 1892286 to 1892330 (45 bp); Desulfomicrobium baculatum DSM 4028 CCCCTCCTGAACAGGCTCAGCCTGAACAGGCTCGGCCTGAACAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1890220-1892877	Sequence	Dbac_1661 - hypothetical protein (Protein is coded in complementary strand; from 1892877 to 1890220)