Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 1007145
End position: 1007168
Length: 24

DNA sequence
>NC_013173, from 1007145 to 1007168 (24 bp); Desulfomicrobium baculatum DSM 4028 GGCATCGTCATCGGCAGCGGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1007089-1008438	Sequence	Dbac_0924 - amino acid permease-associated protein