Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 546210
End position: 546233
Length: 24

DNA sequence
>NC_013173, from 546210 to 546233 (24 bp); Desulfomicrobium baculatum DSM 4028 AGCGACAGCGGCAGCCACAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 545784-546746	Sequence	Dbac_0472 - hypothetical protein (Protein is coded in complementary strand; from 546746 to 545784)