Sequence retrieval

Genome: Desulfomicrobium baculatum DSM 4028
Start position: 363672
End position: 363695
Length: 24

DNA sequence
>NC_013173, from 363672 to 363695 (24 bp); Desulfomicrobium baculatum DSM 4028 CGTCTTCGTCTGTGTCTTCGTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 363236-364555	Sequence	Dbac_0310 - hypothetical protein (Protein is coded in complementary strand; from 364555 to 363236)