Sequence retrieval

Genome: Anaerococcus prevotii DSM 20548
Start position: 854953
End position: 854977
Length: 25

DNA sequence
>NC_013171, from 854953 to 854977 (25 bp); Anaerococcus prevotii DSM 20548 AAGAAAACAAAAGTAAAGATAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 854084-855019	Sequence	Apre_0754 - cation diffusion facilitator family transporter