Sequence retrieval

Genome: Anaerococcus prevotii DSM 20548
Start position: 1874532
End position: 1874561
Length: 30

DNA sequence
>NC_013171, from 1874532 to 1874561 (30 bp); Anaerococcus prevotii DSM 20548 TATTTCTTCTTAGTTCTCCTTATTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1874493-1875125	Sequence	Apre_1731 - methyltransferase GidB (Protein is coded in complementary strand; from 1875125 to 1874493)