Sequence retrieval

Genome: Anaerococcus prevotii DSM 20548
Start position: 1859983
End position: 1860006
Length: 24

DNA sequence
>NC_013171, from 1859983 to 1860006 (24 bp); Anaerococcus prevotii DSM 20548 ATCTACAACTACATTTACATCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1859441-1860244	Sequence	Apre_1713 - alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 1860244 to 1859441)