Sequence retrieval

Genome: Anaerococcus prevotii DSM 20548
Start position: 1785112
End position: 1785135
Length: 24

DNA sequence
>NC_013171, from 1785112 to 1785135 (24 bp); Anaerococcus prevotii DSM 20548 TCATCATCTTCATCATCGTCATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1784272-1785303	Sequence	Apre_1642 - RNA polymerase sigma-32 subunit RpoH (Protein is coded in complementary strand; from 1785303 to 1784272)