Sequence retrieval

Genome: Anaerococcus prevotii DSM 20548
Start position: 1620051
End position: 1620074
Length: 24

DNA sequence
>NC_013171, from 1620051 to 1620074 (24 bp); Anaerococcus prevotii DSM 20548 TGGTGGTGTTGGTGGTGTTGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1619887-1621719	Sequence	Apre_1487 - Cna B domain-containing protein (Protein is coded in complementary strand; from 1621719 to 1619887)