Sequence retrieval

Genome: Anaerococcus prevotii DSM 20548
Start position: 1360222
End position: 1360245
Length: 24

DNA sequence
>NC_013171, from 1360222 to 1360245 (24 bp); Anaerococcus prevotii DSM 20548 TATTTTATTATTTTAGTATTATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1360230-1361432	Sequence	Apre_1268 - phosphoribosylglycinamide synthetase (Protein is coded in complementary strand; from 1361432 to 1360230)