Sequence retrieval

Genome: Anaerococcus prevotii DSM 20548
Start position: 1230687
End position: 1230716
Length: 30

DNA sequence
>NC_013171, from 1230687 to 1230716 (30 bp); Anaerococcus prevotii DSM 20548 TGCTGCTGCTGGAGCTGCTGCTACTGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1230445-1230828	Sequence	Apre_1144 - 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 1230828 to 1230445)