Sequence retrieval

Genome: Anaerococcus prevotii DSM 20548
Start position: 1155469
End position: 1155498
Length: 30

DNA sequence
>NC_013171, from 1155469 to 1155498 (30 bp); Anaerococcus prevotii DSM 20548 TTTTTTCTAAATTTTTATAAATATTTCTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1154202-1155536	Sequence	Apre_1077 - Miro domain-containing protein (Protein is coded in complementary strand; from 1155536 to 1154202)