Sequence retrieval

Genome: Cryptobacterium curtum DSM 15641
Start position: 846474
End position: 846497
Length: 24

DNA sequence
>NC_013170, from 846474 to 846497 (24 bp); Cryptobacterium curtum DSM 15641 CGAATTTGAATTCGAGTTTGAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 846076-847248	Sequence	Ccur_07340 - hypothetical protein (Protein is coded in complementary strand; from 847248 to 846076)