Sequence retrieval

Genome: Cryptobacterium curtum DSM 15641
Start position: 703888
End position: 703932
Length: 45

DNA sequence
>NC_013170, from 703888 to 703932 (45 bp); Cryptobacterium curtum DSM 15641 CAGGCGTTCCTCCAACAGACGTTGCTTCAACGGGCGTTCCCCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 703762-704595	Sequence	Ccur_05990 - nicotinate/nicotinamide nucleotide adenylyltransferase