Sequence retrieval

Genome: Cryptobacterium curtum DSM 15641
Start position: 252248
End position: 252271
Length: 24

DNA sequence
>NC_013170, from 252248 to 252271 (24 bp); Cryptobacterium curtum DSM 15641 GCACCAGCACCAGCGCCAGCACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 250712-252829	Sequence	Ccur_02060 - oxidoreductase (Protein is coded in complementary strand; from 252829 to 250712)