Sequence retrieval

Genome: Cryptobacterium curtum DSM 15641
Start position: 1539202
End position: 1539228
Length: 27

DNA sequence
>NC_013170, from 1539202 to 1539228 (27 bp); Cryptobacterium curtum DSM 15641 CACCAAGAGCACCAGGAGCATCAAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1538049-1539338	Sequence	Ccur_13600 - gamma-glutamylcysteine synthetase (Protein is coded in complementary strand; from 1539338 to 1538049)