Sequence retrieval

Genome: Cryptobacterium curtum DSM 15641
Start position: 1377737
End position: 1377760
Length: 24

DNA sequence
>NC_013170, from 1377737 to 1377760 (24 bp); Cryptobacterium curtum DSM 15641 CACCAACACCATCAGCAATACCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1377102-1377893	Sequence	Ccur_12110 - F0F1-type ATP synthase, alpha subunit (Protein is coded in complementary strand; from 1377893 to 1377102)